User talk:Msommer

From FreeBio

Hej Morten Sommer. Mit navn er Per Koustrup og jeg arbejder på et forskningsprojekt der omhandler Direct Methanol Fuel Cells (DMFC) og brugen af metanol som energibærer i fremtidens energisystem. Jeg har nogle spørgsmål omkring projektet som måske er mere passende at vi tager på mail i stedet for på en åben blog. Jeg kunne dog ikke finde din mailadresse nogen steder, hvorfor jeg har henvendt mig til dig på denne måde. Skriv en mail til mig på pk@h2logic.com og jeg vil specificere mine spørgsmål. På forhånd tusinde tak for hjælpen. Med venlig hilsen Per Koustrup


Morten, I couldn't get the library problem resolved, so regrettably, there's nothing in the database for you to work with. You can see my Image:Jsl13dec.zip, though, and *imagine* that there's stuff there, though.

Copenhagen Consensus, Natural Capitalism

With regard to Lomborg and the Copenhagen Consensus, it's important to remember that even if you accept his project, it was only the Kyoto protocol and global warming in general that the committee decided should not be a high priority. There are plenty of other reasons why switching to biodiesel would be good for the world and for countries making the switch.

Also, I have a few comments w/r/t Natural Capitalism, in that it seems to be more a statement of values rather than any sort of system or anything else that can be used to construct something. Maybe more on this in the class meeting if it seems appropriate. --Jleith 03:24, 4 Oct 2005 (EDT)

Morton it's a "!" not a "|" in your perl script. --ASW 18:07, 1 November 2005 (EST)

Perl

I am running activestate perl on windows XP and I have installed the bioperl package as well.

I have had troubles with this small script for aligning sequences

it gives my the error massage:

Bad name after ktuple' at align.pl line 14

when you have a single quote in a "Bad name" error, it is usually an indication that you don't have a matching quotation mark. When I pasted the code into my Xemacs editor, the syntax highlighting indicated that the offending line appears to be the BEGIN statement. Remove it and see what happens. --JeremyZucker 02:50, 24 November 2005 (EST)

And I have tried for a long time to correct this - anybody knows what I might be doing wrong.

My script for alignment of a couple of sequences align.pl :

#!/usr/bin/perl -w


use Bio::Perl;
BEGIN { $ENV{CLUSTALDIR} = '\site\lib\Bio\AlignIO\' }
use Bio::Tools::Run::Alignment::Clustalw;

$filename = "<xxx.fasta";

#- reads all sequences from a file $filename 
@seq_array = read_all_sequences($filename);   

#Performs allignment
  @params = ('ktuple' => 2, 'matrix' => 'BLOSUM'); 
  $factory = Bio::Tools::Run::Alignment::Clustalw->new(@params);
  $seq_array_ref = \@seq_array;
      # where @seq_array is an array of Bio::Seq objects
  $aln = $factory->align($seq_array_ref);

print "$aln";

My input file xxx.fasta

>U00096 Escherichia coli K-12 MG1655 complete genome.
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC
TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG
TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC
ACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT
AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG
CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGT
ACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG
GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAA
CGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG
CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATT
AGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA
ATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATC
GATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCT

>U00196 Escherichia coli K-12 MG1655 complete genome sub.
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC
TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG
TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC
ACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT
AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG
CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGT
ACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG
GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAA
CGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG
CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATT
AGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA
ATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATC
GATCCAGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCT

>U00296 Escherichia coli K-12 MG1655 complete genome duplication.
AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTC
TGATAGCAGCTTCTGAACTGGTTACCTGCCGTGAGTAAATTAAAATTTTATTGACTTAGG
TCACTAAATACTTTAACCAATATAGGCATAGCGCACAGACAGATAAAAATTACAGAGTAC
ACAACATCCATGAAACGCATTAGCACCACCATTACCACCACCATCACCATTACCACAGGT
AACGGTGCGGGCTGACGCGTACAGGAAACACAGAAAAAAGCCCGCACCTGACAGTGCGGG
CTTTTTTTTTCGACCAAAGGTAACGAGGTAACAACCATGCGAGTGTTGAAGTTCGGCGGT
ACATCAGTGGCAAATGCAGAACGTTTTCTGCGTGTTGCCGATATTCTGGAAAGCAATGCC
AGGCAGGGGCAGGTGGCCACCGTCCTCTCTGCCCCCGCCAAAATCACCAACCACCTGGTG
GCGATGATTGAAAAAACCATTAGCGGCCAGGATGCTTTACCCAATATCAGCGATGCCGAA
CGTATTTTTGCCGAACTTTTGACGGGACTCGCCGCCGCCCAGCCGGGGTTCCCGCTGGCG
CAATTGAAAACTTTCGTCGATCAGGAATTTGCCCAAGATCAGGAATTTGCCCAAATAAAACATGTCCTGCATGGCATT
AGTTTGTTGGGGCAGTGCCCGGATAGCATCAACGCTGCGCTGATTTGCCGTGGCGAGAAA
ATGTCGATCGCCATTATGGCCGGCGTATTAGAAGCGCGCGGTCACAACGTTACTGTTATC
GATCCGGTCGAAAAACTGCTGGCAGTGGGGCATTACCTCGAATCTACCGTCGATATTGCT

Here is your modified code:

#!/usr/bin/perl -w
use strict;

my $ggg; 
$ggg = 3; 
print "hello\n";
print "$ggg\n";

And here is how to run it:

fas% chmod +x foo.pl 
fas% ./foo.pl 
hello
3

Note that you only need to add the execute permission once. --smd 18:44, 1 November 2005 (EST)